View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10018_high_11 (Length: 225)
Name: NF10018_high_11
Description: NF10018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10018_high_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 211
Target Start/End: Original strand, 21144928 - 21145138
Alignment:
| Q |
1 |
tgtagatggatgatcttgttcacctttgcaagtttaatcatgattgctccatggagcttcaagtgaatattgctgagttaagcaaagtacgctctcagaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
21144928 |
tgtagatggatgatcttgttcaccttgacaagtttaatcatgattgctccaaggagcttcaagtgaatattgctgggttaagcaaagtacactctcagaa |
21145027 |
T |
 |
| Q |
101 |
tcatgactttttccttgtacttgatttagagggtaaggttgagattcttgagtttccagttcttaagattagtgcaaagacattgaaagtcgaagacatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21145028 |
tcatgactttttccttgtacttgatttagagggtaaggttgagattcttgagtttccagttcttaagattagtgcaaagacattgaaagtcgaagacatt |
21145127 |
T |
 |
| Q |
201 |
tttcacaggtt |
211 |
Q |
| |
|
||||||||||| |
|
|
| T |
21145128 |
tttcacaggtt |
21145138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University