View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10018_low_11 (Length: 241)
Name: NF10018_low_11
Description: NF10018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10018_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 112 - 223
Target Start/End: Original strand, 2485654 - 2485765
Alignment:
Q |
112 |
aagagagagacacgtaagaatgcatgcatgagtcagcactagtctccatcctttaaacttgaataagagaagaaaataaagaccgcaccagaaatagcgg |
211 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2485654 |
aagagagagacacgtaagaatgcatgcatgagtcagcactagtctccatcatttaaacttgaataagagaagaaaataaagaccgcaccagaaatagcgg |
2485753 |
T |
 |
Q |
212 |
gaactctcataa |
223 |
Q |
|
|
|||||||||||| |
|
|
T |
2485754 |
gaactctcataa |
2485765 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 2485543 - 2485601
Alignment:
Q |
1 |
tttttgaaaaagaaaacggcgtgcattttgaaaattttcttatccacttgagttatggg |
59 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2485543 |
tttttgaaaaagaaaacggcgtgcattttgaaaattttcttatccacttgagttatggg |
2485601 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University