View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10018_low_15 (Length: 205)
Name: NF10018_low_15
Description: NF10018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10018_low_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 17 - 196
Target Start/End: Complemental strand, 11660310 - 11660130
Alignment:
Q |
17 |
aatatcaagaagaaattaacaat-aagtttttaaagaatcgaagtttaaattatgatatagttgaatttacttgtaattggaactgctttgaagcataca |
115 |
Q |
|
|
||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
11660310 |
aatatcaagaagaaattaacaattaagtttttaaagaaacgaagtttaaattatgatatagttgaatttacttgtaattggaactgctttgaagcataca |
11660211 |
T |
 |
Q |
116 |
agatgggaaagccctnnnnnnntcacaaacaggtgaaaaatattgcctttcattcttgtcacttagatttcctatgcttct |
196 |
Q |
|
|
||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
T |
11660210 |
agatgggaaagccctaaaaaaatgacaaacaggtgaaaaatattgcctttcattcttgtcacttagatttcttatgtttct |
11660130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University