View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10018_low_16 (Length: 201)
Name: NF10018_low_16
Description: NF10018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10018_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 51 - 186
Target Start/End: Complemental strand, 4775175 - 4775040
Alignment:
| Q |
51 |
tttgaatcatgttcctgctcgagacaatttatataaaaggagggtcttggtgctgtttgtttttctgtttttgtagtgaacttgaccagttgcatgtttc |
150 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4775175 |
tttgaatcatgttcctgctagagacaatttatttaaaaggagggtcttagtgctgtttgtttttctgtttttgtagtgaacttgaccagttgcatgtttc |
4775076 |
T |
|
| Q |
151 |
tgtaatcttgatgggttggtttcgtacacctatgct |
186 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||| |
|
|
| T |
4775075 |
tctaatcttgatgggttggtttcgtacacctatgct |
4775040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University