View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10018_low_5 (Length: 363)
Name: NF10018_low_5
Description: NF10018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10018_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 85 - 320
Target Start/End: Original strand, 17736084 - 17736315
Alignment:
| Q |
85 |
aagtaataatcttcttcttcccggaggtaatctttataacgannnnnnnnngttgcagaatatgacaaaacatgaatcctacgctaaggaaaggatttgc |
184 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17736084 |
aagtaaaaatcttcttcttcccggaggtaatctttataacgatttttt----ttgcagaatatgacaaaacatgaatcctacgctaaggaaaggatttgc |
17736179 |
T |
 |
| Q |
185 |
ataagattaggaaaagataaatcatagacttatagtacatgatttatattgaatttaatttaggtggattcaacacgccccctctagatagagttacacc |
284 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17736180 |
gtaagattaggaaaagataaatcatagactcatagtacatgatttatattgaatttaatttaggtggattcaacacgccccctctagatagagttacacc |
17736279 |
T |
 |
| Q |
285 |
aggtaacatttatcttggtaagtaaatctacatgtt |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
17736280 |
aggtaacatttatcttggtaagtaaatctacatgtt |
17736315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 1 - 97
Target Start/End: Original strand, 17735977 - 17736073
Alignment:
| Q |
1 |
atttgatatcaagtgccaatttgtattttgataccaaatataataattaatctattgggtccacatttatttacttacgtgatcaagtaataatctt |
97 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17735977 |
atttgatatcaagtggcaatttgtattttgataccaaatataataattaatctattgggtccacatttatttacttacgtgatcaagtaataatctt |
17736073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University