View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10019_high_1 (Length: 909)
Name: NF10019_high_1
Description: NF10019
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10019_high_1 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 216; Significance: 1e-118; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 19 - 283
Target Start/End: Original strand, 32938339 - 32938602
Alignment:
| Q |
19 |
gctctgacctttatagaatgatggggatgctctctgttgtgggacttgtggtatgaaatttattgatttgccatatgtttcttttctgtgagggtttaan |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
32938339 |
gctctgacctttatagaatgatggggatgctctctgttgtgggacttgtggtatgaaatttattgatttgccatatgtttcttttgtgtgagggtttaat |
32938438 |
T |
 |
| Q |
119 |
nnnnnncattatattgtcaaattaactatttgctaattgtttttaggctttggtaattggttttgctcttggcattggaccaatcccttggcttataatg |
218 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32938439 |
tttttt-attatattgtcaaattaactatttactgattgtttttaggctttggtaattggttttgctcttggcattggaccaatcccttggcttataatg |
32938537 |
T |
 |
| Q |
219 |
tctgaggtatgcacaaagacctatttccacttgcagaatttaaatatggttctggcttcactttt |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
32938538 |
tctgaggtatgcacaaagacctatttccacttgctgaatttaaatatggttctggcttcaatttt |
32938602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 104; E-Value: 2e-51
Query Start/End: Original strand, 763 - 895
Target Start/End: Original strand, 32938620 - 32938756
Alignment:
| Q |
763 |
atattattacattgtatgccactgcatatggtaattgat----taattaatggtgtggttttcagatacttccaccaaatattaaggggcttgctggaag |
858 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32938620 |
atattattacaaggtatgccactgcatgtggtaattgataaattaattaatggtttggttttcagatacttccaccaaatattaaggggcttgctggaag |
32938719 |
T |
 |
| Q |
859 |
tgctgcaacatttttgaattggttcactgcctctctg |
895 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32938720 |
tgctgcaacatttttgaattggttcactgcctctctg |
32938756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 155 - 229
Target Start/End: Original strand, 32932545 - 32932619
Alignment:
| Q |
155 |
ttgtttttaggctttggtaattggttttgctcttggcattggaccaatcccttggcttataatgtctgaggtatg |
229 |
Q |
| |
|
||||||| ||| | |||||||||| || |||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32932545 |
ttgttttaaggttatggtaattgggttctctctaggacttggaccaatcccttggcttataatgtctgaggtatg |
32932619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 38; Significance: 0.000000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 158 - 227
Target Start/End: Complemental strand, 7752361 - 7752292
Alignment:
| Q |
158 |
tttttaggctttggtaattggttttgctcttggcattggaccaatcccttggcttataatgtctgaggta |
227 |
Q |
| |
|
|||||||||| |||| ||||| | ||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
7752361 |
tttttaggctatggtgattggctactctcttggacttggaccaatcccttggcttataatgtctgaggta |
7752292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University