View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10019_high_10 (Length: 241)
Name: NF10019_high_10
Description: NF10019
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10019_high_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 95 - 224
Target Start/End: Complemental strand, 4679832 - 4679703
Alignment:
| Q |
95 |
cataatctagtaaatattgcaattaattaccatgcaggagctcnnnnnnnctccccttcttttggtatctcaccaacatatctatctgaattaatttcat |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4679832 |
cataatctagtaaatattgcaattaattaccatgcaggagctctttttttctccccttcttttggtatctcaccaacatatctatctgaattaatttcat |
4679733 |
T |
|
| Q |
195 |
atttgtaagttggtgcaaagtttatcaacc |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
4679732 |
atttgtaagttggtgcaaagtttatcaacc |
4679703 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University