View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10019_high_7 (Length: 257)
Name: NF10019_high_7
Description: NF10019
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10019_high_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 33 - 238
Target Start/End: Original strand, 44534032 - 44534237
Alignment:
Q |
33 |
tacacttaatattacctacttttgccttaaaccaagaacaagatagaattgttttaaatttttatgcaatccaaaacactaatcaaacaaaaaatatcat |
132 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44534032 |
tacacttaatattacctacttttgccttaaaccaagaacaagatagaattgttttaaatttttatgcaatccaaaacactaatcaaacaaaaaatatcat |
44534131 |
T |
 |
Q |
133 |
ctatatagtttgaagaaatgggatatatgaggtcatacttaccgattgaggaagcattaagctttcttcaacaaatagacaaatttatcttaatgtaatt |
232 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44534132 |
ctatatagtttgaagaaatgggatatatgaggtcatacttaccgattgaggaagcattaagctttcttcaacaaatagacaaatttatcttaatgtaatt |
44534231 |
T |
 |
Q |
233 |
cttttc |
238 |
Q |
|
|
|||||| |
|
|
T |
44534232 |
cttttc |
44534237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University