View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10019_low_15 (Length: 238)
Name: NF10019_low_15
Description: NF10019
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10019_low_15 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 163; Significance: 3e-87; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 19 - 222
Target Start/End: Original strand, 32938339 - 32938541
Alignment:
| Q |
19 |
gctctgacctttatagaatgatggggatgctctctgttgtgggacttgtggtatgaaatttattgatttgccatatgtttcttttctgtgagggtttaan |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
32938339 |
gctctgacctttatagaatgatggggatgctctctgttgtgggacttgtggtatgaaatttattgatttgccatatgtttcttttgtgtgagggtttaat |
32938438 |
T |
|
| Q |
119 |
nnnnnncattatattgtcaaattaactatttgctaattgtttttaggctttggtaattggttttgctcttggcattggaccaatcccttggcttataatg |
218 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32938439 |
tttttt-attatattgtcaaattaactatttactgattgtttttaggctttggtaattggttttgctcttggcattggaccaatcccttggcttataatg |
32938537 |
T |
|
| Q |
219 |
tctg |
222 |
Q |
| |
|
|||| |
|
|
| T |
32938538 |
tctg |
32938541 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 155 - 222
Target Start/End: Original strand, 32932545 - 32932612
Alignment:
| Q |
155 |
ttgtttttaggctttggtaattggttttgctcttggcattggaccaatcccttggcttataatgtctg |
222 |
Q |
| |
|
||||||| ||| | |||||||||| || |||| || |||||||||||||||||||||||||||||| |
|
|
| T |
32932545 |
ttgttttaaggttatggtaattgggttctctctaggacttggaccaatcccttggcttataatgtctg |
32932612 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 158 - 222
Target Start/End: Complemental strand, 7752361 - 7752297
Alignment:
| Q |
158 |
tttttaggctttggtaattggttttgctcttggcattggaccaatcccttggcttataatgtctg |
222 |
Q |
| |
|
|||||||||| |||| ||||| | ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
7752361 |
tttttaggctatggtgattggctactctcttggacttggaccaatcccttggcttataatgtctg |
7752297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University