View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10019_low_8 (Length: 265)
Name: NF10019_low_8
Description: NF10019
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10019_low_8 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 253; Significance: 1e-141; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 13 - 265
Target Start/End: Original strand, 34136802 - 34137054
Alignment:
| Q |
13 |
ggacatcatgggcaacatattaccgaggaactcatgctgtaattgcagtgattgacagcagtgatagagctaggatctctttaatgaaggatgaactttt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34136802 |
ggacatcatgggcaacatattaccgaggaactcatgctgtaattgcagtgattgacagcagtgatagagctaggatctctttaatgaaggatgaactttt |
34136901 |
T |
|
| Q |
113 |
caggttgctgggtcatgaagatttacaacattcagtcatccttgtctttgctaataaacaagatatcaaggatgctatgactcctgctgaaatcactgat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34136902 |
caggttgctgggtcatgaagatttacaacattcagtcatccttgtctttgctaataaacaagatatcaaggatgctatgactcctgctgaaatcactgat |
34137001 |
T |
|
| Q |
213 |
gctctgtcacttcacagcatcaaggatcatgattggcatatacaagcttgcag |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34137002 |
gctctgtcacttcacagcatcaaggatcatgattggcatatacaagcttgcag |
34137054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 183 - 259
Target Start/End: Complemental strand, 34150785 - 34150709
Alignment:
| Q |
183 |
gatgctatgactcctgctgaaatcactgatgctctgtcacttcacagcatcaaggatcatgattggcatatacaagc |
259 |
Q |
| |
|
|||||||| ||||||||||| || |||||||| |||| ||| |||||||||| |||||||| |||||| ||||||| |
|
|
| T |
34150785 |
gatgctattactcctgctgagattactgatgcagtgtctctttacagcatcaatgatcatgaatggcatttacaagc |
34150709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University