View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10019_low_9 (Length: 263)
Name: NF10019_low_9
Description: NF10019
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10019_low_9 |
 |  |
|
| [»] scaffold0194 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 25 - 247
Target Start/End: Complemental strand, 32542056 - 32541834
Alignment:
| Q |
25 |
cagaagcaacacgtataacgcaaaatctctacttctttccatagactaaatgataaaggttttcatgttactaggtatgatggaagtgtattttatatac |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||| ||||||||||||||||| |
|
|
| T |
32542056 |
cagaagcaacacgtataacgcaaaatctctacttctttccatagactaaatgataaaggttttcatgttcctaggtgtgatagaagtgtattttatatat |
32541957 |
T |
 |
| Q |
125 |
ctttgttgggtttggtttgcccctcacccctccatatcgtttagattcaacaaaagatcacttttgcaaatatagttcatcactatttcatcttcatttg |
224 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32541956 |
ctttgttgggtttggtttgccccccacccctccatatcgtttagattcaacaaaagatcacttttgcaaatatagttcatcactatttcatcttcatttg |
32541857 |
T |
 |
| Q |
225 |
ctggttaggttttatgagttttg |
247 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
32541856 |
ctggttaggttttatgagttttg |
32541834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 72 - 121
Target Start/End: Complemental strand, 9841922 - 9841872
Alignment:
| Q |
72 |
aaatgataaa-ggttttcatgttactaggtatgatggaagtgtattttata |
121 |
Q |
| |
|
|||||||||| ||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
9841922 |
aaatgataaatggttttcatgttactgggtatgagggaagtgtattttata |
9841872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 26 - 75
Target Start/End: Complemental strand, 29049758 - 29049709
Alignment:
| Q |
26 |
agaagcaacacgtataacgcaaaatctctacttctttccatagactaaat |
75 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| | ||||||| |
|
|
| T |
29049758 |
agaagcaacacgtaaaacgcaaaatctctacttctttccagaaactaaat |
29049709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 230
Target Start/End: Original strand, 46952496 - 46952545
Alignment:
| Q |
181 |
atcacttttgcaaatatagttcatcactatttcatcttcatttgctggtt |
230 |
Q |
| |
|
|||||||||||||||| || ||| |||||||||||||||||||||||||| |
|
|
| T |
46952496 |
atcacttttgcaaatagagctcaacactatttcatcttcatttgctggtt |
46952545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0194 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: scaffold0194
Description:
Target: scaffold0194; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 79 - 121
Target Start/End: Complemental strand, 30100 - 30058
Alignment:
| Q |
79 |
aaaggttttcatgttactaggtatgatggaagtgtattttata |
121 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||||||||| |
|
|
| T |
30100 |
aaaggttttcatgttactaggtatgaggggagtgtattttata |
30058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.00000000009; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 79 - 121
Target Start/End: Original strand, 44184125 - 44184167
Alignment:
| Q |
79 |
aaaggttttcatgttactaggtatgatggaagtgtattttata |
121 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
44184125 |
aaaggttttcatgttactgggtatgagggaagtgtattttata |
44184167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 72 - 121
Target Start/End: Original strand, 7765339 - 7765389
Alignment:
| Q |
72 |
aaatgataaa-ggttttcatgttactaggtatgatggaagtgtattttata |
121 |
Q |
| |
|
|||||||||| || |||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
7765339 |
aaatgataaatggctttcatgttacttggtatgagggaagtgtattttata |
7765389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University