View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1001_low_2 (Length: 351)
Name: NF1001_low_2
Description: NF1001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1001_low_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 66 - 278
Target Start/End: Original strand, 31554082 - 31554294
Alignment:
Q |
66 |
aataggcatagagaaaaagaatgacatgcttggagcattgttggcatctggtgaacagttctcaaacgaggaaatagttgattttatgttggctttgctc |
165 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31554082 |
aataggcatagagaaaaagaatgacatgcttggagcattgttggcatctggtgaacagttctcaaacgaggaaatagttgattttatgttggctttgctc |
31554181 |
T |
 |
Q |
166 |
gttgctggttatgaaactacttctacaattatgactcttgccatcaaatttctcactgaaactcctttagccttggcacaactcaaggtacgtaattaat |
265 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31554182 |
gttgctggttatgaaactacttctacaattatgactcttgccatcaaatttctcactgaaactcctttagccttggcacaactcaaggtacgtaattaat |
31554281 |
T |
 |
Q |
266 |
taccacaatataa |
278 |
Q |
|
|
||||||||||||| |
|
|
T |
31554282 |
taccacaatataa |
31554294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 87 - 255
Target Start/End: Original strand, 35476391 - 35476559
Alignment:
Q |
87 |
tgacatgcttggagcattgttggcatctggtgaacagttctcaaacgaggaaatagttgattttatgttggctttgctcgttgctggttatgaaactact |
186 |
Q |
|
|
||||||||| || ||||||||||||||||| || || || || || || ||||||| ||||| |||||||| || ||||| || || |||||||| || |
|
|
T |
35476391 |
tgacatgctaggtgcattgttggcatctggcgaccacttttccaatgaacaaatagtcgatttcatgttggcattactcgtcgccggatatgaaaccacc |
35476490 |
T |
 |
Q |
187 |
tctacaattatgactcttgccatcaaatttctcactgaaactcctttagccttggcacaactcaaggta |
255 |
Q |
|
|
||||| || ||||| | || |||| |||||||| ||| |||| |||| |||||||||||||||||| |
|
|
T |
35476491 |
tctaccataatgacattcgcggtcaagtttctcaccgaacatcctctagcattggcacaactcaaggta |
35476559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University