View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1002-Insertion-18 (Length: 227)
Name: NF1002-Insertion-18
Description: NF1002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1002-Insertion-18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 88 - 223
Target Start/End: Complemental strand, 54947049 - 54946903
Alignment:
| Q |
88 |
agaatctaattttttatacaatttataaattataaaatgtcaaaatcgtccttttttattgctaacaaacgc-----------ataatgttttgcaattt |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||| ||||||||||| |||| |
|
|
| T |
54947049 |
agaatctaattttttatacaatttataaattataaaatgtcaaaatcgtctttttttattcctaacaaacgcacgttactgtaataatgttttgtgattt |
54946950 |
T |
 |
| Q |
177 |
cattggtgtcgtgcttctcttctatatgttttcatgtttaaaaagat |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54946949 |
cattggtgtcgtgcttctcttctatatgttttcatgtttaaaaagat |
54946903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University