View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1002-Insertion-19 (Length: 57)
Name: NF1002-Insertion-19
Description: NF1002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1002-Insertion-19 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 50; Significance: 2e-20; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 50; E-Value: 2e-20
Query Start/End: Original strand, 8 - 57
Target Start/End: Original strand, 40598653 - 40598702
Alignment:
| Q |
8 |
atcagttgcttcaacttttacgcgcacaagatctcgatttgaaatcagcc |
57 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40598653 |
atcagttgcttcaacttttacgcgcacaagatctcgatttgaaatcagcc |
40598702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 27; E-Value: 0.0000009
Query Start/End: Original strand, 10 - 52
Target Start/End: Complemental strand, 40302882 - 40302840
Alignment:
| Q |
10 |
cagttgcttcaacttttacgcgcacaagatctcgatttgaaat |
52 |
Q |
| |
|
||||||||||| ||||| | |||||||||| |||||||||||| |
|
|
| T |
40302882 |
cagttgcttcagctttttcccgcacaagatatcgatttgaaat |
40302840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University