View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10020_low_6 (Length: 294)
Name: NF10020_low_6
Description: NF10020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10020_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 276
Target Start/End: Complemental strand, 41358848 - 41358574
Alignment:
| Q |
1 |
tctgttggattatactactctatatatatttgtttnnnnnnnnnnttgatacggaactcaaaaaatttctcaagtcatggaactcacatttaattcataa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
41358848 |
tctgttggattatactactctatatatatttgttttaaaaaaaa-ttgatacggaactcaaaaaatttctcaagtcatggaaatcgcatttaattcataa |
41358750 |
T |
|
| Q |
101 |
gaaatatacaagctttaggaaactatttatgaatgaactcggatattagatagagaggtaatttatatactcaatatcgaaagttttggttaaagatgtg |
200 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
41358749 |
gaaatatacatgctttaggaaactatttatgaatgaactcggatattagatagagaggtaatctatatactcaatatcgaaggttttggttaaagatgtg |
41358650 |
T |
|
| Q |
201 |
gtgtatcgatgatcctctatcattagcctgttgctctcggcgcttcccctcactcggaaacacgtggtaccagagc |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
41358649 |
gtgtatcgatgatcctctatcattagcctgttgctctcggcgcttcccctcactcggaaacaagtggtaccagagc |
41358574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University