View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10021_high_1 (Length: 545)
Name: NF10021_high_1
Description: NF10021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10021_high_1 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 411; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 411; E-Value: 0
Query Start/End: Original strand, 18 - 527
Target Start/End: Original strand, 27189714 - 27190221
Alignment:
| Q |
18 |
acaccttcttctctcattccattacccttccctttcccactctcttcatccaccaaacgacactgtttcaaactctcactcccacgctcttcatcatcct |
117 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||| ||||| ||||| |||| |
|
|
| T |
27189714 |
acaccttcttctctcattccatcacccttccctttcccactctcttcatccaccaaacgacaccgtttcaaactcccactccctcgctcatcatcctcct |
27189813 |
T |
|
| Q |
118 |
cctccgttcctccgcccaaagacctcaccggaatcgaaaacgtcgttgacaaactatcgccaccactccgtctcgctacatccgccgttgttattgctgg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
27189814 |
cctccgttcctccgcccaaagacctcaccggaatcgaaaacgtcgtcgacaaactatcaccaccactccgtctcgctacatccgccgttgttattgccgg |
27189913 |
T |
|
| Q |
218 |
cgcagtagccgcgggatttcatctcggctcgaaattcggtggaagtcgaaatgctgctgttggaggagcggttgctttgggtgcggctggtggtgcggct |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
27189914 |
cgcagtagccgcgggatttcatctcggctccaaattcggtggaagtcgaaatgctgctgttggaggagctgttgctttgggtgcggctggtggtgcggct |
27190013 |
T |
|
| Q |
318 |
gcgtatgctcttaatgccatggcgccgcaagtcgcggctgtgaatttgcataactatgttgctgatcttgatcatcctttgttgttgaagaaggaagaca |
417 |
Q |
| |
|
||||||||||||||||||||||||||||| || ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27190014 |
gcgtatgctcttaatgccatggcgccgcaggttgcggccgtgaatttgcataactatgttgctgatcttgatcatcctttgttgttgaagaaggaagaca |
27190113 |
T |
|
| Q |
418 |
ttgataaaatcgccaataggtttatttgaattgatgtttaattttgtacgcgttaaatttattgtattatattatactatactttcagtgacagtgtgat |
517 |
Q |
| |
|
|||| || |||||||||||||||||||||||||||||||||| |||||||||||||| ||||| ||||||| ||||||||||| |||||||| ||||| |
|
|
| T |
27190114 |
ttgagaatatcgccaataggtttatttgaattgatgtttaatattgtacgcgttaaacttattatattatactatactatactgacagtgaca--gtgat |
27190211 |
T |
|
| Q |
518 |
ttaatttgat |
527 |
Q |
| |
|
|||||||||| |
|
|
| T |
27190212 |
ttaatttgat |
27190221 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University