View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10021_high_10 (Length: 241)
Name: NF10021_high_10
Description: NF10021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10021_high_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 35095733 - 35095506
Alignment:
Q |
1 |
ctaggaataggctttgttgaaaggtattggccttagtccccctttctattgtttttctttttggtggaatatataggtgatgctttctgcatcatcagtt |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35095733 |
ctaggaataggctttgttgaaaggtattggccttagttcccctttctattgtttttctttttggtggaatatataggtgatgctttctgcatcatcagtt |
35095634 |
T |
 |
Q |
101 |
tatt--nnnnnnnnnttgttaagggtgaaaagacatttatagcaactgaatcaaaattattggattt--nnnnnnnnncattgatgtcttttgttaacac |
196 |
Q |
|
|
|||| ||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
35095633 |
tattaaaaaaaaaaattgctaagggtgaaaagacatttatagcaactgaatcaaaattattggatttaaaaaaaaaaacattgatgtcttttgttaacac |
35095534 |
T |
 |
Q |
197 |
aaaagtatttattttttagagtccatcc |
224 |
Q |
|
|
|||||||||| ||||||||||||||||| |
|
|
T |
35095533 |
aaaagtatttcttttttagagtccatcc |
35095506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 54 - 97
Target Start/End: Original strand, 20599215 - 20599258
Alignment:
Q |
54 |
tttctttttggtggaatatataggtgatgctttctgcatcatca |
97 |
Q |
|
|
|||||||||||||| ||||||||||||||||| |||||||||| |
|
|
T |
20599215 |
tttctttttggtggtatatataggtgatgcttcatgcatcatca |
20599258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University