View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10021_high_6 (Length: 368)
Name: NF10021_high_6
Description: NF10021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10021_high_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 44; Significance: 6e-16; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 127 - 174
Target Start/End: Original strand, 3427713 - 3427760
Alignment:
| Q |
127 |
tcagtttgtgttgtgcgtgtgtgtagtgagatagaagagggaagaaaa |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
3427713 |
tcagtttgtgttgtgcgtgtgtgtagtgagatagaagatggaagaaaa |
3427760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 8 - 42
Target Start/End: Original strand, 3427594 - 3427628
Alignment:
| Q |
8 |
ttggtgttgtggtgatgtgctggttctgttctgca |
42 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
3427594 |
ttggtgttgtggtgatgtgctggttctgttatgca |
3427628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 176 - 248
Target Start/End: Original strand, 29235403 - 29235475
Alignment:
| Q |
176 |
aagtttgcatgttcaagtacactgcaactatttattcaatacaactttgtattcctcgccgcaagcacatttt |
248 |
Q |
| |
|
|||||| ||||||||||||||||||| || | |||||||| |||||||||||||||| || || ||||||||| |
|
|
| T |
29235403 |
aagttttcatgttcaagtacactgcagctgtgtattcaatgcaactttgtattcctcaccacaggcacatttt |
29235475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University