View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10021_low_23 (Length: 228)
Name: NF10021_low_23
Description: NF10021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10021_low_23 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 154; Significance: 8e-82; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 3 - 168
Target Start/End: Complemental strand, 31364783 - 31364618
Alignment:
| Q |
3 |
ttggtgtgaagaatacatccctaagtttatttgcacttttgcacccctatattatcacatagatcaaaattacaacaaatgtaataactaattgagaaaa |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||| ||| |
|
|
| T |
31364783 |
ttggtgtgaagaatacatccctaagtttatttgcacttttgcatccctatattatcacatagatcaaaattacaactaatgtaataactaattgagcaaa |
31364684 |
T |
|
| Q |
103 |
aagtgatttcaagataaatgaaatatattgaagagcataatgtatgcacatgtgataacaataatc |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31364683 |
aagtgatttcaagataaatgaaatatattgaagagcataatgtatgcacatgtgataacaataatc |
31364618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 180 - 212
Target Start/End: Complemental strand, 31364603 - 31364571
Alignment:
| Q |
180 |
agtgttatcgtttttagtaataattttttgctt |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
31364603 |
agtgttatcgtttttagtaataattttttgctt |
31364571 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University