View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10021_low_24 (Length: 227)

Name: NF10021_low_24
Description: NF10021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10021_low_24
NF10021_low_24
[»] chr4 (1 HSPs)
chr4 (28-206)||(4673903-4674081)


Alignment Details
Target: chr4 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 28 - 206
Target Start/End: Original strand, 4673903 - 4674081
Alignment:
Q  28 gtttggtgtttgtagccgttggattagggagagtatccatctgagggtgatgaagtgggatagcttatcctcttgcttatctggggttggtgacatggat 127  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  4673903 gtttggtgtttgtagccgttggattagggagagtatccatctgagggtgatgaagtgggatagcttatcctcttgcttatctggggttggtgacatggat 4674002  T
Q  128 ttcgatgtggaccaactttttgtccttgatagtgattgctcctagagaacttgtggctgtggctcatagattatatgca 206  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  4674003 ttcgatgtggaccaactttttgtccttgatagtgattgctcctagagaacttgtggctgtggttcatagattatatgca 4674081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University