View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10022_high_2 (Length: 350)
Name: NF10022_high_2
Description: NF10022
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10022_high_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 169 - 331
Target Start/End: Original strand, 779672 - 779833
Alignment:
| Q |
169 |
aactattagtcatgatccttgtgttattgatgtcttgttgagtatttttgaannnnnnnnnnatgaatgataataattgtgtctgtttgacatttttata |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
779672 |
aactattagtcatgatccttgtgttattgatgtcttgttgagtattttagaatgttttttt-atgaatgataacaattgtgtctgtttgacatttttata |
779770 |
T |
 |
| Q |
269 |
tgattataacatgagttttgatactaattcttgagctgagaatgttagttgtttattaatttc |
331 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
779771 |
tgattataacatgagttttgatactaattcttgagctgagaatgttagttgtttattaatttc |
779833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 15 - 107
Target Start/End: Original strand, 779518 - 779610
Alignment:
| Q |
15 |
aacgatgagaagtccggggttgggacggagaagaaggatggggaaagtggcttagcaggtaagaaaataacgaatttcattctttgccctagc |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
779518 |
aacgatgagaagtccggggttgggacggagaagaaggatggggaaagtggcttagcaggtaagaaaataacgaatttcattctttgccctagc |
779610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University