View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10022_high_5 (Length: 323)
Name: NF10022_high_5
Description: NF10022
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10022_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 129; Significance: 9e-67; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 129; E-Value: 9e-67
Query Start/End: Original strand, 16 - 156
Target Start/End: Complemental strand, 40193816 - 40193677
Alignment:
| Q |
16 |
ataaccacttgaaaaaatggaatatagagttgttagatctaagcggaagaaaaatgaggtgatgaatgagagagatctaaaacataggtattacatcgca |
115 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40193816 |
ataaccactt-aaaaaatggaatatagagttgttagatctaagcggaagaaaaatgaggtgatgaatgagagagatctaaaacataggtattacatcgca |
40193718 |
T |
 |
| Q |
116 |
agctttgacaatagatctaacatgaagtacatcaatgtaaa |
156 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
40193717 |
agctttgacaatagatctaagatgaagtacatcaatgtaaa |
40193677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 252 - 317
Target Start/End: Complemental strand, 40193601 - 40193536
Alignment:
| Q |
252 |
tctttattttctcttatctctatcatattatacacattttcggtgaataatcacatcctatgattc |
317 |
Q |
| |
|
||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
40193601 |
tctttatcttctcttatctctatcatatcatacacattttcggtgaataatcacatccaatgattc |
40193536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University