View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10022_high_6 (Length: 250)
Name: NF10022_high_6
Description: NF10022
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10022_high_6 |
 |  |
|
| [»] scaffold1099 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold1099 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: scaffold1099
Description:
Target: scaffold1099; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 41 - 243
Target Start/End: Original strand, 382 - 584
Alignment:
| Q |
41 |
cttatggcctggtttcctgcatgatattttcatttaatatagcattgtaatctgtatggagacctcagcaagatgttaacactatacattatcaggttgt |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
382 |
cttatggcctggtttcctgcatgatatttttatttaatatagcattggaatctgtatggagacctcagcaagatgttaacactatacattatcaggttgt |
481 |
T |
 |
| Q |
141 |
gaaaccacttttacacgagaggacaagaagaaaagtgcaggtcttatcaggatgcggacgagaggagttgttaaatgtaagatttttgtttttgcctttg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
482 |
gaaaccacttttacacgagaggacaagaagaaaagtgcaggtcttatcaggatgtggacgagaggagttgttaaatgtaagatttttgtttttgcttttg |
581 |
T |
 |
| Q |
241 |
ctt |
243 |
Q |
| |
|
||| |
|
|
| T |
582 |
ctt |
584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 133 - 186
Target Start/End: Complemental strand, 9886727 - 9886674
Alignment:
| Q |
133 |
caggttgtgaaaccacttttacacgagaggacaagaagaaaagtgcaggtctta |
186 |
Q |
| |
|
||||||||||| ||||||||||| |||||||| || | ||||||||| |||||| |
|
|
| T |
9886727 |
caggttgtgaagccacttttacaagagaggactaggaaaaaagtgcaagtctta |
9886674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University