View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10022_low_12 (Length: 232)
Name: NF10022_low_12
Description: NF10022
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10022_low_12 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 15 - 232
Target Start/End: Original strand, 31925497 - 31925715
Alignment:
| Q |
15 |
tcaaatgataaccacttaagtaaatggttgtgcactccaattatgaaccaaattagaatccaaaaacatagtctcaactagcataaaatcaagacaatac |
114 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||| |||| |||||||||||||||||||||||||||||||||||| ||| |||||||||||| |||||| |
|
|
| T |
31925497 |
tcaaatgataaccacttaagtaa-tggctgtgca-tccatttatgaaccaaattagaatccaaaaacatagtctcagctaacataaaatcaaggcaatac |
31925594 |
T |
 |
| Q |
115 |
cagaaacaaaactgcagcaacaccaactggcacatacagaacaataaaggagagcaatggtcgaaccaacggcaaagaactaca---ccagccaaagctt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||| ||| ||| |||||||||||||| ||||||||| || |
|
|
| T |
31925595 |
cagaaacaaaactgcagcaacaccaactggcacacacaagacaataaaggagagcaatggctgaaacaatggcaaagaactacaactgcagccaaagatt |
31925694 |
T |
 |
| Q |
212 |
aagggaaccctgcacccaaac |
232 |
Q |
| |
|
|| ||||||||||||||||| |
|
|
| T |
31925695 |
aacagaaccctgcacccaaac |
31925715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 38 - 103
Target Start/End: Complemental strand, 24511514 - 24511449
Alignment:
| Q |
38 |
atggttgtgcactccaattatgaaccaaattagaatccaaaaacatagtctcaactagcataaaat |
103 |
Q |
| |
|
|||| |||||| | |||||| |||| |||||| |||||||||| ||||||||||||| ||| |||| |
|
|
| T |
24511514 |
atggatgtgcatttcaattacgaacaaaattacaatccaaaaatatagtctcaactaacatgaaat |
24511449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University