View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10025_high_5 (Length: 318)
Name: NF10025_high_5
Description: NF10025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10025_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 1 - 303
Target Start/End: Original strand, 36695113 - 36695415
Alignment:
| Q |
1 |
ccaccaactagaattgttgttaccctatcttgtgcagtatcaattatctcatggtctctataacttgatacagataccaaacaaaatgtcaagataaaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36695113 |
ccaccaactagaattgttgttaccctatcttgtgcagtatcaattatctcatggtctctataacttgatacagataccaaacaaaatgtcaagataaaca |
36695212 |
T |
 |
| Q |
101 |
ctagcaaaccataatcatatcttgccttcattagaggtataaatcgaatatatgtagcccctgcagctgaaatgattnnnnnnncatgcattggttagta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
36695213 |
ctagcaaaccataatcatatcttgccttcattagaggtataaatcgaatatatgtagcccctgcagctgaaatgattaaaaaaaaatgcgttggttagta |
36695312 |
T |
 |
| Q |
201 |
ttgtttttgatagttcttactggtgaaattatgaaatatacaatcagagaagtaaatattacttgctagaaatattatgattccaagaagtataggttca |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36695313 |
ttgtttttgatagttcttactggtgaaattatgaaatatacaattagagaagtaaatattacttgctagaaatattatgattccaagaagtataggttca |
36695412 |
T |
 |
| Q |
301 |
att |
303 |
Q |
| |
|
||| |
|
|
| T |
36695413 |
att |
36695415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University