View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10025_high_8 (Length: 243)
Name: NF10025_high_8
Description: NF10025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10025_high_8 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 32 - 228
Target Start/End: Original strand, 29612147 - 29612343
Alignment:
Q |
32 |
acttgggattacaatcaacggtgagtacaaattgaggtttttggtttctgttccttctagcttgtaggtttctagctcattcttaaccagtgaatcactt |
131 |
Q |
|
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29612147 |
acttgggaccacaatcaacggtgagtacaaattgaggtttttggtttctgttccttctagcttgtaggtttctagctcattcttaaccagtgaatcactt |
29612246 |
T |
 |
Q |
132 |
ttttaaattacatatattaggtcataaaatcccctcatacaaacacatggcaaacattactgaattcttgttatattgcagaattttcagaatgttg |
228 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29612247 |
ttttaaattacatatattaggtcataaaatcccctcatacaaacacatggcaaacattactgaattcttgttatattgcagaattttcagaatgttg |
29612343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University