View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10025_low_8 (Length: 286)
Name: NF10025_low_8
Description: NF10025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10025_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 24 - 277
Target Start/End: Complemental strand, 40508817 - 40508564
Alignment:
Q |
24 |
ggagggttactcgtgccaccactaggttgaggagcagaaccatttggtgataactgtggagatatctttggtacttgatgttgtggaggtgatgctgatg |
123 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40508817 |
ggagggttactcgtgccaccactaggttgaggagcagaaccatttggtgataactgtggagatatctttggtacttgatgttgtggaggtgatgctgatg |
40508718 |
T |
 |
Q |
124 |
gtgttggtggattttttgggggaatttgatggatattaataataactttttggcctaaagtacaataatttgagacactacatataaagtagtagacacc |
223 |
Q |
|
|
||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||| |
|
|
T |
40508717 |
gtgttggtggattttgtgggggaatttgatggacattaataataactttttggcctaaagtacaataatttgagacactacatatgaagtagtagatacc |
40508618 |
T |
 |
Q |
224 |
tctttcctttaatgggaaatttactgggctactgttgaataccttcacaggttc |
277 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
40508617 |
tctttcctttaatgggaaatttactgggctactgttgaataccttcagaggttc |
40508564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University