View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10026_high_9 (Length: 258)
Name: NF10026_high_9
Description: NF10026
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10026_high_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 2 - 248
Target Start/End: Original strand, 18938368 - 18938616
Alignment:
| Q |
2 |
tcggctcgaaattttgttccctactttattcttagttgaattaagtcattctttttaaggaaaagtcatattcaactatcacattgattata--tttgat |
99 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
18938368 |
tcggctcgaaattctgttccctactttattcttagttgaattaagtcattctttttaaggaaaagtcatattcaactatcacattgattatatatttgat |
18938467 |
T |
 |
| Q |
100 |
accgatagttggttagatccattttggtcgttggaatcttaaaacattaaacctattgacgtatccttaagatattttgcattaattaggaactggttat |
199 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18938468 |
actgatagttggttagatccattttggtcgttggaatcttaaaacattaaacctattgacgtatccttaagatattttgcattaattaggaactggttat |
18938567 |
T |
 |
| Q |
200 |
atgataattcttctagaagtgaacacactttctagcctaagcttctctg |
248 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
18938568 |
atgataattcttctagaagcgaacacactttctagcctaagcttctctg |
18938616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 84 - 125
Target Start/End: Complemental strand, 20105653 - 20105612
Alignment:
| Q |
84 |
attgattatatttgataccgatagttggttagatccattttg |
125 |
Q |
| |
|
||||||||||| |||||||| ||||||||| ||||||||||| |
|
|
| T |
20105653 |
attgattatatctgataccgttagttggttggatccattttg |
20105612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 66 - 134
Target Start/End: Complemental strand, 34409385 - 34409317
Alignment:
| Q |
66 |
gtcatattcaactatcacattgattatatttgataccgatagttggttagatccattttggtcgttgga |
134 |
Q |
| |
|
|||| ||||||| ||| |||| ||||||||||||||| ||||| ||| | ||| |||||||||||||| |
|
|
| T |
34409385 |
gtcacattcaacggtcagattgtttatatttgataccgttagttagttgggtccgttttggtcgttgga |
34409317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University