View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10026_low_8 (Length: 309)
Name: NF10026_low_8
Description: NF10026
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10026_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 1 - 290
Target Start/End: Original strand, 44974805 - 44975094
Alignment:
| Q |
1 |
tacaagagttcaaggattcatgaaatttgtacactttttagaaggttttggaagatcatataccgaacaaaacaactactgttgacaaacacagcagaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44974805 |
tacaagagttcaaggattcatgaaatttgtacactttttagaagattttggaagatcatataccgaacaaaacaactactgttgacaaacacagcagaag |
44974904 |
T |
 |
| Q |
101 |
cattacttgttggtcttgttttaggaacaatttacataaacattgggtttgataaagaagggattgagaaaaggtttggtctttttgcattcactctaac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44974905 |
cattacttgttggtcttgttttaggaacaatttacataaacattgggtttgataaagaagggattgagaaaaggtttggtctttttgcattcactctaac |
44975004 |
T |
 |
| Q |
201 |
attcctcttatcttccacaactgaaacacttccaatctttatcaatgagagaccaatcttgttaagagaaacatcaagtggtgtttatag |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44975005 |
attcctcttatcttccacaactgaaacacttccaatctttatcaatgagagaccaatcttgttaagagaaacatcaagtggtgtttatag |
44975094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University