View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10027_low_2 (Length: 256)
Name: NF10027_low_2
Description: NF10027
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10027_low_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 3965690 - 3965916
Alignment:
| Q |
1 |
ttgcatctttcattctcttgaacgttttaccatcctccatcacttaggtaagttctgaaattttcaagaaacattaaaa-catgtatttactgaacaaaa |
99 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
3965690 |
ttgcatctttcattctcttaaacgttttaccatcctcca-----------agttctgaaatttttaagaaacattaaaaacatgtatttactgaacaaaa |
3965778 |
T |
 |
| Q |
100 |
aactcattaaaaatttgttcaaacaaattgtttatgaatggatattccaacaatctattaaaacttcatacaaaaggaccgatatagatattgtcacata |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3965779 |
aactcattaaaaatttgttcaaacaaattgtttatgaatggatattccaacaatctattaaaacttcatacaaaaggaccgatatagatattgtcacata |
3965878 |
T |
 |
| Q |
200 |
ttttgttacaaagatactatatgatattgatgtgagagagg |
240 |
Q |
| |
|
||||||| |||| | |||||||||||||||||||||||| |
|
|
| T |
3965879 |
ttttgttgcaaaca---tatatgatattgatgtgagagagg |
3965916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University