View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10027_low_3 (Length: 217)
Name: NF10027_low_3
Description: NF10027
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10027_low_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 122; Significance: 9e-63; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 42 - 200
Target Start/End: Complemental strand, 42669732 - 42669574
Alignment:
| Q |
42 |
tgtacaatattcattttcatatacctaagtttccagagtttttcttgtatatactaaatcaaccaaagnnnnnnnatttgatgtctggcttaaagaccga |
141 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
42669732 |
tgtacaatattcattttcatatacgtaagtttctagagtttttcttgtatatactacatcaaccaaagtttttttatttgatgtctggcttaaagaccga |
42669633 |
T |
 |
| Q |
142 |
ctaattccatcgttcattagcgagggtgtcaattgaagttagagcaaattttttatgaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
42669632 |
ctaattccatcgttcattagcgagggtgtcaattgaagttagagcaaaatttttatgaa |
42669574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 14 - 48
Target Start/End: Complemental strand, 42669948 - 42669914
Alignment:
| Q |
14 |
cagagaacttgcaagatagcaaagaaattgtacaa |
48 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |
|
|
| T |
42669948 |
cagagaacttgcaagatagcaaagaaactgtacaa |
42669914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University