View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10030_high_18 (Length: 246)

Name: NF10030_high_18
Description: NF10030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10030_high_18
NF10030_high_18
[»] chr7 (1 HSPs)
chr7 (16-230)||(36345155-36345369)


Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 16 - 230
Target Start/End: Original strand, 36345155 - 36345369
Alignment:
16 gatggaagacaagggagtgaaatgcagccctatgttgaagcaccgcctaatgcgtcagaacaaaatcgttattcacatcgatcaattgagacattgatag 115  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
36345155 gatggaagacaagggagtgaaatgcagccctatgttgaagcaccgcctaatgcggcagaacaaaatcgttattcacatcgatcaattgagacattgatag 36345254  T
116 tggtgatagcagtgatcactatagtaggtgtgattgcaggaatgattgcaaggttgtgtggtggaagacactttggaggaaatggtgagaatgatataga 215  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36345255 tggtgatagcagtgatcactatagtaggtgtgattgctggaatgattgcaaggttgtgtggtggaagacactttggaggaaatggtgagaatgatataga 36345354  T
216 aggttgggttgaaag 230  Q
    |||||||||||||||    
36345355 aggttgggttgaaag 36345369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University