View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10030_high_20 (Length: 239)

Name: NF10030_high_20
Description: NF10030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10030_high_20
NF10030_high_20
[»] chr5 (1 HSPs)
chr5 (1-223)||(800751-800973)


Alignment Details
Target: chr5 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 800973 - 800751
Alignment:
1 tgcatggttactaggaaactggagatagtggtaagtcatgacttagaagtaataaatgatttcaagaggattgagcaaatggctttggttggattatggt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||| ||||||||||||||||||||||||||||||    
800973 tgcatggttactaggaaactggagatagtggtaagtcatgacttagaagtactcaatgatttcaagaggtttgagcaaatggctttggttggattatggt 800874  T
101 gtcttcatccaaacccaactcttagaccttcaatgaagaaagtgactcaaatgctagagggaacagtggaagttggggttccacctttgctttatgatca 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
800873 gtcttcatccaaacccaactcttagaccttcaatgaagaaagtgactcaaatgctagagggaacagtggaagttggggttccacctttgctttatgatca 800774  T
201 gatgatggcaaatcagaactctt 223  Q
    |||||||||||||||||||||||    
800773 gatgatggcaaatcagaactctt 800751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University