View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10030_high_20 (Length: 239)
Name: NF10030_high_20
Description: NF10030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10030_high_20 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 800973 - 800751
Alignment:
| Q |
1 |
tgcatggttactaggaaactggagatagtggtaagtcatgacttagaagtaataaatgatttcaagaggattgagcaaatggctttggttggattatggt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
800973 |
tgcatggttactaggaaactggagatagtggtaagtcatgacttagaagtactcaatgatttcaagaggtttgagcaaatggctttggttggattatggt |
800874 |
T |
|
| Q |
101 |
gtcttcatccaaacccaactcttagaccttcaatgaagaaagtgactcaaatgctagagggaacagtggaagttggggttccacctttgctttatgatca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
800873 |
gtcttcatccaaacccaactcttagaccttcaatgaagaaagtgactcaaatgctagagggaacagtggaagttggggttccacctttgctttatgatca |
800774 |
T |
|
| Q |
201 |
gatgatggcaaatcagaactctt |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
800773 |
gatgatggcaaatcagaactctt |
800751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University