View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10030_low_22 (Length: 252)

Name: NF10030_low_22
Description: NF10030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10030_low_22
NF10030_low_22
[»] chr1 (2 HSPs)
chr1 (187-242)||(48393252-48393307)
chr1 (1-62)||(48393065-48393126)


Alignment Details
Target: chr1 (Bit Score: 56; Significance: 3e-23; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 187 - 242
Target Start/End: Original strand, 48393252 - 48393307
Alignment:
187 ctctgaacccgtggttttcattgcgacgcatataacactcttcttatccctctctg 242  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48393252 ctctgaacccgtggttttcattgcgacgcatataacactcttcttatccctctctg 48393307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 48393065 - 48393126
Alignment:
1 catttccatgtacttttaggcaatttcttacgttggaaaaatcaatgttgagcaaagagtaa 62  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||    
48393065 catttccatgtacttttaggcaatttcttacgtgggaaaaatcaatgttgaacaaagagtaa 48393126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University