View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10030_low_22 (Length: 252)
Name: NF10030_low_22
Description: NF10030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10030_low_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 56; Significance: 3e-23; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 187 - 242
Target Start/End: Original strand, 48393252 - 48393307
Alignment:
| Q |
187 |
ctctgaacccgtggttttcattgcgacgcatataacactcttcttatccctctctg |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48393252 |
ctctgaacccgtggttttcattgcgacgcatataacactcttcttatccctctctg |
48393307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 48393065 - 48393126
Alignment:
| Q |
1 |
catttccatgtacttttaggcaatttcttacgttggaaaaatcaatgttgagcaaagagtaa |
62 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
48393065 |
catttccatgtacttttaggcaatttcttacgtgggaaaaatcaatgttgaacaaagagtaa |
48393126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University