View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10030_low_24 (Length: 249)
Name: NF10030_low_24
Description: NF10030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10030_low_24 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 2 - 249
Target Start/End: Complemental strand, 801395 - 801150
Alignment:
| Q |
2 |
tggagaagcagagagacctcaatggagtcaaagggttgaaatggctcttggaatagcaagaggcttactctacttgcatgaagagtgtgaaacgcagatc |
101 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
801395 |
tggagaaggagagagacctcaatggagtcaaagggttgaaatggctcttggaatagcaagaggcttactctacttgcatgaagagtgtgaaacgcagatc |
801296 |
T |
 |
| Q |
102 |
atacatattgtgatatcaagccacaaaatgtgttacttgatgctaatcatattgcaaagattgcagattttggactttccaagcttttgaacaaagatca |
201 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
801295 |
atacat--tgtgatatcaagccacaaaatgtgttacttgatgctaatcatattgcaaagattgcagattttggactttccaagcttttgaacaaagatca |
801198 |
T |
 |
| Q |
202 |
aaccagaataagtacaaattttagagggacaataaggtacatagcacc |
249 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
801197 |
aaccagaacaagtacaaattttagagggacaatagggtacatagcacc |
801150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 112 - 141
Target Start/End: Original strand, 11041068 - 11041097
Alignment:
| Q |
112 |
tgatatcaagccacaaaatgtgttacttga |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
11041068 |
tgatatcaagccacaaaatgtgttacttga |
11041097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 113 - 141
Target Start/End: Original strand, 11026366 - 11026394
Alignment:
| Q |
113 |
gatatcaagccacaaaatgtgttacttga |
141 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
11026366 |
gatatcaagccacaaaatgtgttacttga |
11026394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University