View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10030_low_25 (Length: 246)
Name: NF10030_low_25
Description: NF10030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10030_low_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 16 - 230
Target Start/End: Original strand, 36345155 - 36345369
Alignment:
| Q |
16 |
gatggaagacaagggagtgaaatgcagccctatgttgaagcaccgcctaatgcgtcagaacaaaatcgttattcacatcgatcaattgagacattgatag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36345155 |
gatggaagacaagggagtgaaatgcagccctatgttgaagcaccgcctaatgcggcagaacaaaatcgttattcacatcgatcaattgagacattgatag |
36345254 |
T |
 |
| Q |
116 |
tggtgatagcagtgatcactatagtaggtgtgattgcaggaatgattgcaaggttgtgtggtggaagacactttggaggaaatggtgagaatgatataga |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36345255 |
tggtgatagcagtgatcactatagtaggtgtgattgctggaatgattgcaaggttgtgtggtggaagacactttggaggaaatggtgagaatgatataga |
36345354 |
T |
 |
| Q |
216 |
aggttgggttgaaag |
230 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
36345355 |
aggttgggttgaaag |
36345369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University