View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10030_low_8 (Length: 392)
Name: NF10030_low_8
Description: NF10030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10030_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 325; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 325; E-Value: 0
Query Start/End: Original strand, 1 - 376
Target Start/End: Complemental strand, 48393028 - 48392652
Alignment:
| Q |
1 |
tagttaaccaccgtttgatttttaatcatttccacatgtttttaagcaacttttt-atttaggaatagcaattttcttctttgttttatacttgggcctg |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
48393028 |
tagttaaccaccgtttgatttttaatcatttccacgtgtttttaagcaacttttttatttaggaaaagcaattttcttctttgttttatacttgggcctg |
48392929 |
T |
 |
| Q |
100 |
taaataaagcccatttaggatggtccaagcccaatatgcactatgaagcccagattagtttgtcaagaaaaaatgaagcctggctataaatgaggtcaag |
199 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48392928 |
taaatggagcccatttaggatggtccaagcccaatatgcactatgaagcccagattagtttgtcaagaaaaaatgaagcctggctataaatgaggtcaag |
48392829 |
T |
 |
| Q |
200 |
cagaaaagatgattgatttataggcttctcgcattgctccaaagtccttgagatttatcgaattgtaaccgctgatcacacaaaatcaactatgagttat |
299 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
48392828 |
caggaaagatgattgatttataggcttctcgcattgctcaaaagtccttgagatttatcgaattgtaactgctgatcacacaaaatcaactctgagttat |
48392729 |
T |
 |
| Q |
300 |
gctacgatcgttttattgcataggtgtgtaactttcaatccgtccagataatggttgagtttggttgggtcggattt |
376 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
48392728 |
gctacgatcgttttattgcataggtatgtaactttcaatccgccaagataatggttgagtttggttgggtcggattt |
48392652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University