View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10031_high_5 (Length: 245)
Name: NF10031_high_5
Description: NF10031
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10031_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 134; Significance: 7e-70; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 95 - 235
Target Start/End: Complemental strand, 40660096 - 40659955
Alignment:
| Q |
95 |
gtcatgctttgtgaaggttgaacttggttgttgtcctgtttggagcctatggtttacagggcatgtaggaattgggtatcagcttgatagtagtgtgcaa |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40660096 |
gtcatgctttgtgaaggttgaacttggttgttgtcctgtttggagcctatggtttacagggcatgtaggaattgggtatcagcttgatagtagtgtgcaa |
40659997 |
T |
 |
| Q |
195 |
gccaaatgttccatgatgtgcttc-ttgttgtttgttgatgt |
235 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
40659996 |
gccaaatgttccatgatgtgcttctttgttgtttgttgatgt |
40659955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 17 - 65
Target Start/End: Complemental strand, 40660175 - 40660127
Alignment:
| Q |
17 |
acatcactgctgcaggatttaaaaggtggtgtgtggctagtggtgcaga |
65 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40660175 |
acatcactgctgcaggatttaaaaggtggtgtgtggctagtggtgcaga |
40660127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University