View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10031_low_10 (Length: 245)

Name: NF10031_low_10
Description: NF10031
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10031_low_10
NF10031_low_10
[»] chr4 (2 HSPs)
chr4 (95-235)||(40659955-40660096)
chr4 (17-65)||(40660127-40660175)


Alignment Details
Target: chr4 (Bit Score: 134; Significance: 7e-70; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 95 - 235
Target Start/End: Complemental strand, 40660096 - 40659955
Alignment:
95 gtcatgctttgtgaaggttgaacttggttgttgtcctgtttggagcctatggtttacagggcatgtaggaattgggtatcagcttgatagtagtgtgcaa 194  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40660096 gtcatgctttgtgaaggttgaacttggttgttgtcctgtttggagcctatggtttacagggcatgtaggaattgggtatcagcttgatagtagtgtgcaa 40659997  T
195 gccaaatgttccatgatgtgcttc-ttgttgtttgttgatgt 235  Q
    |||||||||||||||||||||||| |||||||||||||||||    
40659996 gccaaatgttccatgatgtgcttctttgttgtttgttgatgt 40659955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 17 - 65
Target Start/End: Complemental strand, 40660175 - 40660127
Alignment:
17 acatcactgctgcaggatttaaaaggtggtgtgtggctagtggtgcaga 65  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
40660175 acatcactgctgcaggatttaaaaggtggtgtgtggctagtggtgcaga 40660127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University