View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10031_low_6 (Length: 396)
Name: NF10031_low_6
Description: NF10031
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10031_low_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 123 - 378
Target Start/End: Complemental strand, 15936133 - 15935878
Alignment:
| Q |
123 |
ttaattattgaaaatatttgattggctgcttttaagggtgaggtgttaggttcggcttcacgtaattagggnnnnnnngtttgttatatccaaaacagta |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
15936133 |
ttaattattgaaaatatttgattggctgcttttaagggtgaggtgttaggttcggcttcacgtaattagggtttttttgtttgttatatccaaaacagta |
15936034 |
T |
 |
| Q |
223 |
gggttaaatactcatactcaaatatcacgtaacctaacctaacctgcctgctaaacaaacacaaacagatacaggatggcttccggctccggcaacgtcg |
322 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15936033 |
gggttaaatactcatactaaaatatcacgtaacttaacctaacctgcctgctaaacaaacacaaacagatacaggatggcttccggctccggcaacgtcg |
15935934 |
T |
 |
| Q |
323 |
tggacgaaaagttcgacccactcattcggcaagtggccatcagattggcaaacaag |
378 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
15935933 |
tggacgaaaagttcgacccgctcattcggcaagtggccatcagattggcaaacaag |
15935878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University