View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10032_5 (Length: 381)
Name: NF10032_5
Description: NF10032
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10032_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 308; Significance: 1e-173; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 14 - 377
Target Start/End: Original strand, 18874889 - 18875252
Alignment:
Q |
14 |
gaaacctccgcaaaatgagattcaatggtcaacactcaatttcggtatgtagccatcatcacttacgtttagacttgtacacgagatggatctagttcgt |
113 |
Q |
|
|
||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||| || |||||||||||||||||||||||| |
|
|
T |
18874889 |
gaaaccttcgcaaaatgaggttcaatggtcaacactcaatttcggtatgtagccatcaccacttacgtttagcctcgtacacgagatggatctagttcgt |
18874988 |
T |
 |
Q |
114 |
tttctcctcctacctcgaatcagaacaattcttgcgatggaaccatgatagatcatcctccaacgcgcctgatccaagttgtcgcagctcacaacttggt |
213 |
Q |
|
|
|||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
18874989 |
tttctcctcctagcccgaatcagaacaattcttgcgatggaaccatgatagatcatcctccaacacgcctgatccaagttgtcgcagctcacaacttggt |
18875088 |
T |
 |
Q |
214 |
gatccatatacaaagatatataatcacaattcacaacccaaggtgagcgcattacacatatggaaaatgcacaaatctaagttccctaccgagaaggtca |
313 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||| | ||||||||||| | ||| |||||||||||||||||||||| |
|
|
T |
18875089 |
gatccatatacaaagatatataatcacaattcacaacccaaggtgagcacattacacgtgtggaaaatgcatagatccaagttccctaccgagaaggtca |
18875188 |
T |
 |
Q |
314 |
gtgggtgaatgctaacgtcaggcgcgatgcagtcctccaacttgaagaaacaatgtttatgccc |
377 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
18875189 |
gtgggtgaatgctaacgtcaggcgcgatgcagtcctccaacttgaagaaacaatgtttatgccc |
18875252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University