View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10034_high_13 (Length: 203)
Name: NF10034_high_13
Description: NF10034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10034_high_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 12 - 186
Target Start/End: Complemental strand, 24561307 - 24561133
Alignment:
| Q |
12 |
agtagcataggttcattctacaatggttattatcagaatcatcctggtttgtttcagatgaataatataggatcttcttcttcatcttcagtgatgggaa |
111 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
24561307 |
agtaacataggttcattctacaatggttattatcagaatcatcctggtttgtttcagatgaataatataggatcttcttcttcatcttcggtgatgggaa |
24561208 |
T |
 |
| Q |
112 |
ataatggtggtggttctagtgggatttatagtaatagtggagggttaattagtaataatgctgttgaggaatttg |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24561207 |
ataatggtggtggttctagtgggatttatagtaatagtggagggttaattagtaataatgctgttgaggaatttg |
24561133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University