View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10034_high_9 (Length: 249)
Name: NF10034_high_9
Description: NF10034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10034_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 16 - 230
Target Start/End: Original strand, 49584464 - 49584678
Alignment:
| Q |
16 |
caagaggttggcactcggaggaacctagatgttataattatgttccttgtaagaattctatggtcttccttgtccctcgagttaaacagttttcgaggaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
49584464 |
caagaggttggcactcggaggaacctagatgttataattatgttccttgtaagaattctatggtcttccttgtcccccgagttaaacagttttcaaggaa |
49584563 |
T |
 |
| Q |
116 |
tctgctgaagggggtacaatatttcgattctccgtttgaaatcctcaataaagttgcgtccaatcctgagctcattgatctagagaaaaatgcaacggta |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49584564 |
tctgctgaagggggtacaatatttcgattctccgtttgaaatcctcaataaagttgcgtccaatcctgagctcattgatctagagaaaaatgcaacggta |
49584663 |
T |
 |
| Q |
216 |
attccacctcgggag |
230 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
49584664 |
attccacctcgggag |
49584678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University