View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10035_low_12 (Length: 206)
Name: NF10035_low_12
Description: NF10035
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10035_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 24 - 186
Target Start/End: Original strand, 19643194 - 19643356
Alignment:
| Q |
24 |
ggaagttatcagcccattctcctttgtagtaatctccattaggtagaaccctctctgcatggtatacttctgtttcatccttgctttcttcttcatgatc |
123 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19643194 |
ggaagttatcagcccattctcctttatagtaatctccattgggtagaaccctctctgcatggtatacttctgtttcatccttgctttcttcttcatgatc |
19643293 |
T |
|
| Q |
124 |
tacatgttgtgaagctatatatgttgatccaaatatgctatttgcacgcttcttcgcaactgc |
186 |
Q |
| |
|
| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19643294 |
tccatgttgtgaagctacatatgttgatccaaatatgctatttgcacgcttcttcgcaactgc |
19643356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University