View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10035_low_7 (Length: 253)
Name: NF10035_low_7
Description: NF10035
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10035_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 19643427 - 19643665
Alignment:
| Q |
1 |
tacatctggaatggaaaacctttccaccaaatacttaaaatttcatgaatatatatgccttgataatgnnnnnnnnnnnnnnnnntcataacaagattat |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
19643427 |
tacatctggaatggaaaatctttccaccaaatacttaaaatttcatgaatatatatgccttgataatgaaaaattaaaaataaaatcataacaagattat |
19643526 |
T |
|
| Q |
101 |
tgtatcattaatgtagtaatagcatgcaattttatcaatagcttgtggggctttctctcttctaagctgaaaccaacacatgcatgttggtgtaagattt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
19643527 |
tgtatcattaatgtagtaatagcatgcaattttatcaatagcttgtggggctttctctcttgtaagctgaaaccaacacatgcatgttggtataagattt |
19643626 |
T |
|
| Q |
201 |
ttggttctcatgat-ttcttgggtatgtaaagttgatgt |
238 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
19643627 |
ttggttctcatgatattcttgggtatgtaaagttgatgt |
19643665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University