View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10035_low_9 (Length: 240)
Name: NF10035_low_9
Description: NF10035
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10035_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 13122198 - 13122422
Alignment:
Q |
1 |
caaagtgttaccatatatagatggaattaaatcaccttctctctcatgattgcagttcatgtggtttttgtgagtggggaaggacaaattccaaataaaa |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||| |
|
|
T |
13122198 |
caaagtgttaccatatatagatggaattaaatcaccttctctctcatgattgcagttcatgtggtttttgtgagtggggaaggagaaattcaaaataaaa |
13122297 |
T |
 |
Q |
101 |
aattaaaagatgaggatgagggagagaaatgatgacagagttagaaacactaatacactatgaatttgagtccatagtattagtg-ttgacatggtgcgt |
199 |
Q |
|
|
|||||||||||||||||||||||| |||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
13122298 |
aattaaaagatgaggatgagggagggaaatgatgagagagatagaaacactaatacactatgaatttgagtccatagtattagtgtttgacatggtgcgt |
13122397 |
T |
 |
Q |
200 |
tctctatgttatttgtgtggctctt |
224 |
Q |
|
|
||||||||||||||||||||||||| |
|
|
T |
13122398 |
tctctatgttatttgtgtggctctt |
13122422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University