View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10036_high_12 (Length: 279)
Name: NF10036_high_12
Description: NF10036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10036_high_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 1 - 259
Target Start/End: Complemental strand, 7499314 - 7499056
Alignment:
Q |
1 |
agattctttaccagccaaaaactgaggatgatttttctttgcagcagtgctgaatcccataaaaacaagtgtctgattaacaaatgacatttgagccatt |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
T |
7499314 |
agattctttaccagccaaaaactgaggatgatttttctttgcagcagtgctgaatcccataaaaacaagtggctgattaacaaatgacatttgagccatt |
7499215 |
T |
 |
Q |
101 |
ggatgaaacctaggcaccacaaaaacatctccttgctgaactctaaacctcttgtttttgcatttgtcatcattgttgcttccacataccactcttacca |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7499214 |
ggatgaaacctaggcaccacaaaaacatctccttgctgaactctaaacctcttgtttttgcatttgtcatcattgttgcttccacataccactcttacca |
7499115 |
T |
 |
Q |
201 |
ttccttccccttccaacaccactgctacttctgttgccattggattccaatgtggcccc |
259 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7499114 |
ttccttccccttccaacaccactgctacttctgttgccattggattccaatgtggcccc |
7499056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University