View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10036_high_13 (Length: 269)
Name: NF10036_high_13
Description: NF10036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10036_high_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 248; Significance: 1e-138; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 1 - 252
Target Start/End: Original strand, 27813320 - 27813571
Alignment:
| Q |
1 |
ttgctcgagctttggtgcgaaaggcagaacttatgcttcttgatgaagcaacaagtgcacttgatgccgaatccgagaggtctgttcaggaggccctcga |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27813320 |
ttgctcgagcttttgtgcgaaaggcagaacttatgcttcttgatgaagcaacaagtgcacttgatgccgaatccgagaggtctgttcaggaggccctcga |
27813419 |
T |
 |
| Q |
101 |
acgtgcctgctcgggaaaaacaactatcattgttgcacacaggctatcaactataaggaatgccaatctcattgcagtgattgatgatgggacagttgaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27813420 |
acgtgcctgctcgggaaaaacaactatcattgttgcacacaggctatcaactataaggaatgccaatctcattgcagtgattgatgatgggacagttgaa |
27813519 |
T |
 |
| Q |
201 |
gaacaaggctcacattcacatttgttgaaaaatcacccggatgggatctatg |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27813520 |
gaacaaggctcacattcacatttgttgaaaaatcacccggatgggatctatg |
27813571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 36 - 73
Target Start/End: Complemental strand, 38525318 - 38525281
Alignment:
| Q |
36 |
cttcttgatgaagcaacaagtgcacttgatgccgaatc |
73 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
38525318 |
cttcttgatgaagctacaagtgcacttgatgcagaatc |
38525281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 87; Significance: 9e-42; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 30 - 252
Target Start/End: Complemental strand, 41174455 - 41174233
Alignment:
| Q |
30 |
cttatgcttcttgatgaagcaacaagtgcacttgatgccgaatccgagaggtctgttcaggaggccctcgaacgtgcctgctcgggaaaaacaactatca |
129 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||||| ||||| ||||| || ||||| ||||| || || || || | ||||||||||||| || | |
|
|
| T |
41174455 |
cttatgcttcttgacgaggcaacaagtgcacttgatgctgaatcagagagatcagttcaagaggcgctagaccgcgcttcaacgggaaaaacaaccataa |
41174356 |
T |
 |
| Q |
130 |
ttgttgcacacaggctatcaactataaggaatgccaatctcattgcagtgattgatgatgggacagttgaagaacaaggctcacattcacatttgttgaa |
229 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||| | ||||| |||||||||||||| | ||| | || ||||| ||||||||||| ||| |||| |
|
|
| T |
41174355 |
ttgttgcacataggctatcaactatcaggaatgccaatgtgattgctgtgattgatgatggtaaagtagctgagcaaggttcacattcacagttgatgaa |
41174256 |
T |
 |
| Q |
230 |
aaatcacccggatgggatctatg |
252 |
Q |
| |
|
|||||| | ||||||||| |||| |
|
|
| T |
41174255 |
aaatcatcaggatgggatatatg |
41174233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University