View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10036_high_8 (Length: 362)
Name: NF10036_high_8
Description: NF10036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10036_high_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 228; Significance: 1e-126; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 103 - 343
Target Start/End: Original strand, 8825413 - 8825655
Alignment:
| Q |
103 |
agaagtgcaacaccaaagaagttaatcccggttcatttatgctatttggtaagatgatacatttacatcctgttgaaagtaatttgcatgattctgctac |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8825413 |
agaagtgcaacaccaaagaagttaatcccggttcatttattctatttggtaagatgatacatttacatcctgttgaaagtaatttgcatgattctgctac |
8825512 |
T |
 |
| Q |
203 |
caagggagaagatggttgtatgggctgcaataattgaaggcattcatagaatttgctgcacataaataactcagcaagctatgcgaaaatagttatgtaa |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8825513 |
caagggagaagatggttgtatgggctgcaataattgaaggcattcatagaatttgctgcacataaataactcagcaagctatgcgaaaatagttatgtaa |
8825612 |
T |
 |
| Q |
303 |
acgacaagatgt--atgaagttttaccgtacaaatataataca |
343 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
8825613 |
acgacaagatgtacatgaagttttaccgtacaaatataataca |
8825655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 13 - 104
Target Start/End: Original strand, 8825233 - 8825324
Alignment:
| Q |
13 |
ccacagcaactactaccaactttttgaatgttaaggccaatgatttaattgagaaaaattcaatggcaaggttggatattgtgtcaattgag |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8825233 |
ccacagcaactactaccaactttttgaatgttaaggccaatgatttaattgagaaaaattcaatggcaaggttggatattgtgtcaattgag |
8825324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University