View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10036_low_19 (Length: 260)
Name: NF10036_low_19
Description: NF10036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10036_low_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 18 - 115
Target Start/End: Complemental strand, 2176550 - 2176453
Alignment:
| Q |
18 |
cagagaaatgctaatttgatatcttatcaatttcaatatgaaagtagttttagcaacatnnnnnnntgactgataatttgtattttcaacatctaact |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
2176550 |
cagagaaatgctaatttgatatcttatcaatttcaatatgaaagtagttttagcaacataaaaaaatgactgataatttgtcttttcaacatctaact |
2176453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 180 - 242
Target Start/End: Complemental strand, 2176388 - 2176326
Alignment:
| Q |
180 |
gttttacttctaagaacaatttattcgagtcaatcagttaattattgattttcttgacattgg |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2176388 |
gttttacttctaagaacaatttattcgagtcaatcagttaattattgattttcttgacattgg |
2176326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University